Erate; 4, marked. So the biopsies have been from distinctive stages of gastritis (Dixon et al., 1996).Genotyping for cagA and vacA GenesH. pylori infection status was detected by fast urease test, bacterial culture, 13 Curea D-Ribonolactone web breath test, and histological examination (Vaira et al., 1999). In patients with positive culture, H. pylori isolates were subcultured to get a maximum of five passages, and genomic DNA was extracted to genotype for the cagA and vacA genes, as previously described (Argent et al., 2008). The primers applied for PCR amplification and nucleotide sequencing are listed in Supplementary Table 1.Cell Line and H. pylori StrainsAGS (a human gastric cancer cell line) purchased in the cell bank of Chinese Academy of Sciences, have been cultured in F12 cell culture medium (Gibco, Grand Island, NY, USA, 11765054) supplemented with ten FBS (Gibco, 10099141) within a humidified incubator (5 CO2 ) at 37 C. The starvation condition was established by culturing the cells with serumfree medium for four h. The widetype cagA vacA H. pylori strain, NCTC11637 (HpWT, obtained from ATCC), cagAknockout H. pylori with NCTC11637 background (Hp cagA, kindly offered by Dr. Sasakawa (Asahi et al., 2000; Suzuki et al., 2009) and H. pylori cagAknockout complementation mutant (HpccagA, constructed by our group), have been cultured on brainheart infusion medium (10 rabbit blood) under microaerophilic circumstances (five O2 , 10 CO2 , and 85 N2 ) at 37 C. HpccagA mutant was obtained by amplifying the cDNA fragments of cagA gene in the gene of NCTC11637 by polymerase chain reactionMATERIALS AND Methods Sufferers and SpecimensConsecutive sufferers who underwent upper endoscopy because of dyspeptic symptoms at Southwest Hospital, Chongqing, China in the course of January 2013 and December 2014, had been recruited. 1 hundred and six (49 females and 57 men with age of 43 20 years) patients were eligible for enrollment in to the H. pylori positive group if they had a positive [13 C] urea breath test, a good fast urease test, and H. pylori culture. Eleven (six females and five guys with age of 35 20 years) with normal gastric mucosa were eligible for enrollment in to the H. pylori unfavorable group, and also the clinical qualities areFrontiers in Cellular and Infection Microbiology www.frontiersin.orgSeptember 2017 Volume 7 ArticleLi et al.CagA Negatively Regulates Autophagy(PCR), and also the primers of PCR is following: forward: 5 G CGCTCGAGATGACTAACGAACC3 ; reverse: five GCGCTGC AGTTAAGATTTTTGG3 . The solution of PCR was digested with XhoI and PstI, and after that ligating the cDNA fragments of cagA gene among cagAupstream and downstream sequences cloned on the pHel3 shuttle vector. The pHel3 shuttle vector with cagA gene was electroporated into Hp cagA cells carrying the kanamycin resistance. HpccagA clones were cultured in brainheart infusion medium as earlier described. AGS cells transfected with plasmids andor siRNAs were infected with HpWT, Hp cagA, or HpccagA, respectively, with distinctive multiplicity of infection (MOI = ten, 50, 100, 200), for 6 h. Cells with out infection served as controls. The supernatant of AGS cells with various remedy were detected by DuoSet ELISA Improvement Method (IL8, IL1, and TNF; R D, Minneapolis, USA) as our preceding study (Tang et al., 2016).Transfection of AGS With Plasmids andor siRNAsThe GFPMAP1LC3B plasmid and RFPMAP1LC3B 20-HETE Immunology/Inflammation expression plasmid have been kindly provided by Dr. Tamotsu Yoshimori (Division of Cell Biology, National Institute for Basic Biology, Presto, Japan).
