Share this post on:

Sed from Shanghai Watson Biotech PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/27321907 (Shanghai, China). The goat anti-mouse IgG/ fluorescein isothiocyanate (FITC) antibody and the horseradish peroxidase-labeled goat anti-mouse IgG were purchased from Zhongshan Goldbridge Biotechnology (Beijing, China). The anti-ALV-J monoclonal antibody JE-9 was kindly Pan-RAS-IN-1 web provided by Professor Qin Aijian (Yangzhou University, China). All other chemicals were of analytical reagent grade.Design and construction of miRNA expression vector Design of miRNAFour pairs of miRNAs sequences were designed against the conserved regions of the gag gene (NC-015116 gag) using online software http://rnaidesigner.invitrogen.com/ rnaiexpress/ (Table 1). Designed miRNA sequences were synthesized by Shanghai Health Bioengineering (China). Double-stranded oligonucleotide encoding pre-miRNA sequence were annealed and inserted into the linearized expression vector, pcDNA6.2-GW/EmGFP-miR (5 ng/ L), to construct recombinant PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/29069523 plasmids containing the target miRNAs, designated mi-gag1318, mi-gag1365, migag1623, mi-gag1971. All recombinant plasmids have been sequenced to confirm the sequences inserted.Construction of miRNA expression vectors in seriesMaterials and methodsViruses and cellsThe SD strains of ALV-J were isolated from poultry in Shandong, China, and stored at the Harbin Veterinary Research Institute (Harbin, China), a Key State Laboratory. The DF-1 cell lines [9] were provided by Zhigao Bu at the Harbin Veterinary Research Institute (Harbin, China).ReagentsTwo tandem plasmids were constructed based on the migag1318 plasmid backbone. After BglI and XhoI digestion of mi-gag1318, the miRNA sequence of the pol gene (NC015116 pol), mi-pol2516 (constructed previously, manuscript submitted), was digested with SalI and BglI, and ligated to mi-gag1318. The tandem plasmid consisting of mi-gag1318 and mi-pol2516 was designated mi-g1318p2516. The mi-g1318-e1384 (env gene: NC-015116 env) and mi-p2516-e1384 plasmids were constructed in the same way. Plasmids were linearized and used to transform E. coli TOP10. Positive clones were selected and verified by digestion with XhoI and SalI and sequencing. Similarly, based on the recombinant plasmid mi-g1318-p2516 backbone, a tandem plasmid consisting of mi-gag1318, mipol2516 and mi-env1384 was constructed in the same way and designated mi-g1318-p2516-e1384. Positive clones were verified by double digestion with XhoI and SalI and sequencing.Transfection of recombinant plasmid and preparation of ALVThe linearized the pcDNA6.2-GW/EmGFP-miR eukaryotic expression vector, Escherichia coli TOP10 cellsDF-1 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) containing 100 U/mL of penicillinMeng et al. Virology Journal 2011, 8:556 http://www.virologyj.com/content/8/1/Page 3 ofTable 1 Oligonucleotide sequences of pre-miRNAsSequence (5′ to 3′) mi-gag1318 mi-gag1365 mi-gag1623 mi-gag1971 TGCTGTTGATCACAAGACTGGCTGATGTTTTGGCCACTGACTGACATCAGCCACTTGTGATCAA CCTGTTGATCACAAGTGGCTGATGTCAGTCAGTGGCCAAAACATCAGCCAGTCTTGTGATCAAC TGCTGTAGTGATTAAGACAGAGGGACGTTTTGGCCACTGACTGACGTCCCTCTCTTAATCACTA CCTGTAGTGATTAAGAGAGGGACGTCAGTCAGTGGCCAAAACGTCCCTCTGTCTTAATCACTAC TGCTGATCATTGCGGAACAGCTATTGGTTTTGGCCACTGACTGACCAATAGCTTCCGCAATGAT CCTGATCATTGCGGAAGCTATTGGTCAGTCAGTGGCCAAAACCAATAGCTGTTCCGCAATGATC TGCTGTTATGTCTCCCTCAGACTTATGTTTTGGCCACTGACTGACATAAGTCTGGGAGACATAA CCTGTTATGTCTCCCAGACTTATGCAGTCAGTGGCCAAAACATAAGTCTGAGGGAGACATAACand streptomycin, and containing 5 (v/v) fetal calf serum (PAA GOLD, Austria). Twenty-four hours b.

Share this post on: